Please use this identifier to cite or link to this item: http://hdl.handle.net/10397/85996
Title: Expressing the human HMGB1 gene
Authors: Li, Li-jun
Degree: Ph.D.
Issue Date: 2005
Abstract: The high mobility group protein B1 (HMGB1) is a ubiquitous and abundant protein found in higher eukaryotes and has been widely studied as nuclear proteins that bind DNA, stabilize nucleosomes and facilitate gene transcription. Recently, HMGB1 attracts considerable interest because of its "double life" as a nuclear factor and a secreted protein. HMGB1 was found to be released into the extracellular space by various cell types and play an important role in the regulation of cell migration, differentiation, tumorigenesis and inflammation. Previous studies in our laboratory have identified a silencer within the -270 to -219 region immediately upstream of the core promoter of the human hmgb1 gene. In the present study, functional deletion analyses have revealed that two negative regulatory elements exist within this silencer. One negative regulatory element is located in the -225/-219 region and this element, in itself, can repress the HMGB1 core promoter activity down to just one-tenth. From the results of 3'-end deletion analysis, the existence of a second negative regulatory element has also been indicated in the -270/-240 region, and it can repress the hmgb1 promoter activity down to just one-fifth. Using the full-length human hmgb1 silencer of the -270/-219 region, two specific DNA-nuclear protein complexes have been observed by EMSA analysis. However, further EMSA and competition analyses illustrated the possibility that three nuclear proteins might associate with different regions of the silencer. The results have shown that the sequences CTTTGCCCGG from -259 to -250, CATACACACA, from -249 to -240, and CATTCAGATTTGCGCGCTGTT from -239 to -219 are required for the binding reactions. Competition EMSA analyses have indicated that the sequences from -259 to -250, and from -239 to -219 are involved in formation of the two DNA-protein complexes with the full-length silencer. In addition, mutation analyses showed that the three DNA sequences, TTGCCCGG (-257 to -250), CACACATT (-243 to -236) and GCGCGCTG (-228 to -221) are critical protein binding sites in the hmgb1 silencer. A strong correlation is found between the results from deletion analyses and those from EMSA analyses. The two negative regulatory elements located in the -270/-240, and -225/-219 regions, as determined by deletion analyses, coincide with the two binding site located in the -257/-250, and -228/-221 regions determined by EMSA analyses. Another binding site determined by EMSA analyses in the -243/-236 region is correlated with the region between the two negative regulatory elements. Therefore, we believe that these negative regulatory elements must probably function through binding of nuclear protein factors on the silencer DNA. The activities of the human hmgb1 promoter, silencer and enhancer in different cells have also been analyzed in this study. Results from the transfection experiments showed that the human hmgb1 promoter, silencer and enhancer were all functional in the five human cell lines, including the cervix carcinoma cell HeLa, the embryo kidney cell 293, the breast adenocarcinoma cell MCF-7, the liver carcinoma cell BEL7404 and the colon adenocarcinoma cell HT-29. The activities of these three elements have also been examined in four non-human mammalian cell lines. Except in the Chinese hamster ovary cell CHO-K1, the human hmgb1 promoter activity showed stronger activities than the control SV4O promoter. However, the human HMGB1 silencer was apparently active only in the mouse 3T3 and the rat C6 cells, but not in the African green monkey COS-1 and the Chinese hamster CHO-K1 cells. Meanwhile the enhancer appeared to function only in the COS-1 cells, but not in the other three cell lines. Therefore, it appears that the three regulatory elements do not exhibit any cell type-specificity in the human body. However, between cells originated from different mammalian species, the activities of these regulatory elements have varied. There appears to be certain extent of species-specificity. But, since only one cell type from each of the four species was used in this study, our results are not confirmatory. More cell lines from different species will need to be used in future studies to determine the species-specificity of these three human elements. The nuclear extracts from the above nine cell lines have been used in EMSA analysis on the human hmgb1 silencer DNA and the two typical DNA-protein complexes were detected with the nuclear extracts from seven of the nine cell lines. With the nuclear extracts from the COS-1 and CHO-K1 cells, only one DNA-protein complex was observed. These EMSA results correlate well with those of the transfection studies in which the silencer has been found to be non-functional in these two cell lines. To investigate whether the human hmgb1 silencer could exert its effect on a heterologous promoter, the full-length silencer was inserted upstream of the heterologous SV4O promoter in the luciferase reporter vector pGL3-Control. Transfection results showed that the activity of the SV4O promoter has not been affected by the human hmgb1 silencer, either in the human or in the non-human mammalian cell lines used in this study. It suggests that the silencer might function in a promoter-specific or position-dependent manner.
Subjects: Hong Kong Polytechnic University -- Dissertations
Protein binding
Human genetics
Genetic transcription
Pages: xx, 139 leaves : ill. ; 30 cm
Appears in Collections:Thesis

Show full item record

Page views

198
Last Week
2
Last month
Citations as of Apr 12, 2026

Google ScholarTM

Check


Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.